Abstract:This paper investigates the completeness and cocompleteness of some categories of Yoneda complete metric spaces. It is shown that if the morphisms are chosen to be Yoneda continuous maps or Yoneda continuous nonexpansive maps, then the category is both complete and cocomplete; if the morphisms are chosen to be Yoneda continuous Lipschitz maps, then the category is finitely complete and finitely cocomplete, but neither complete nor cocomplete. It is also shown the category of real-valued continuous lattice and Yoneda continuous right adjoints is complete.

Abstract:Powerdomains in domain theory play an important role in modeling the semantics of nondeterministic functional programming languages. In this paper, we extend the notion of powerdomain to the category of directed spaces and define the notion of lower powerspace of a directed space in the way of free algebras. Then we prove the existence of the lower powerspace over any directed space exists and give its concrete structure. Generally, the lower powerspace of a directed space is different from the lower powerdomain of a dcpo endowed with the Scott topology and the observationally-induced lower powerspace introduced by Battenfeld and Schoder in 2015.

Abstract:In this paper, we give some results on both asymptotical almost periodicity and global exponential stability of the solutions of a class of fuzzy cellular neural networks with time-varying delays. The concrete forms of the asymptotical almost solutions of this system are presented.

Abstract:In this paper, we characterize the boundedness and compactness of the Toeplitz operator between doubling Fock spaces in terms of averaging functions and t-Berezin transform.

Abstract:In this paper, we study the existence of infinite positive solutions and oscillation of connected component of positive solutions for a class of periodic boundary value problems of first order difference equations. The proof of the main results is based on the Rabinowitz global bifurcation theorems.

Abstract:We study the existence of positive solutions for a class of fourth-order boundary value problem. The proof of the main results is based on the Dancer global bifurcation technique.

Abstract:The existence of sign-changing solutions for a fractional autonomous Kirchhoff equation is considered in the whole space. We prove that this equation is equivalent to a fractional autonomous Schr&odinger system under appropriate conditions. Then, by using the existence of radial sign-changing solution of the fractional autonomous Schrodinger equation, the existence of solutions for the fractional autonomous Schrodinger system is proved. The existence of radial sign-changing solution for the fractional autonomous Kirchhoff equation is obtained as well.

Abstract:With the rapid development of mobile Internet, the number of mobile devices has surged to a record high. Recognizing and analyzing mobile traffic from a large number of mixed traffic is the first step to study the characteristics of mobile Internet. It can also provide valuable information for mobile network measurement and management, mobile security and privacy protection. This paper summarizes the common methods of network traffic identification, and proposes a mobile traffic identification method based on multidimensional statistical characteristics of data flow. This method extracts the representative features of data stream from three aspects: hardware features, operating system fingerprints and user usage habits, and analyses the features. An ensemble learning method is used to generate the recognition model. The accuracy of mobile traffic identification and five mainstream operation classification results are more than 99%. Compared with the UAFs method mentioned in this paper, the accuracy is improved by about 8%. The features extracted by this method are multidimensional and have practical significance. The features integrate the data flow characteristics network layer and transport layer. Compared with the method using deep packet inspection detection, this method is suitable for the classification of encrypted traffic.

Abstract:One of the challenging in scene text recognition is to deal with distortions or irregular layout. Especially, perspective text and curved text are common in natural scenes and are difficult to recognize. In this paper, we propose an attention enhanced network with flexible rectification function for Arbitrary shape scene text recognition. The network consists of a text rectification network and an attention enhanced recognition network. The rectification network adaptively rectifies the text in the input image to reduce the difficulty recognition. The recognition network is an attention enhanced sequencetosequence model that predicts a character sequence directly from the rectified image. With end to end training approach, only images and corresponding text labels are required. Extensive experiments have been conducted on a variety of open datasets, including SVT, ICDAR 2003 and CUTE80, and the experimental results shows the proposed network has excellent performance.

Abstract:Implicit sentiment analysis is an important part of emotional computing, especially sentiment analysis based on deep learning has become a research hotspot in recent years. This paper uses convolutional neural network to extract features from text, combines longshortterm memory network (LSTM) structure to extract context information, and adds attention mechanism to the network to construct a new hybrid neural network model to realize implicit emotions analysis on text. The hybrid neural network model extracts more meaningful semantic features such as sentence semantics and structure from the hierarchical structure of word level and sentence level respectively, attention is paid to the characteristics of large emotional contribution rate through attention mechanism. The proposed model has a classification accuracy of 77% on the public implicit sentiment data set and can improve the effect of text emotion analysis more comprehensively.

Abstract:Traditional Graph cuts algorithm can effectively extract the foreground of cartoon images, but satisfactory results are not achieved for natural scene images. In order to improve the performance of foreground extraction, this paper proposes the foreground extraction model based on multiscale smoothing, which combines segmentation and multiscale feature to extract foreground from appropriate scale features. The total variation edgepreserved smoothing model is used to smooth the image, which preserves the edges and reduces the inhomogeneity of the image, finally, improves the performance of foreground extraction. Experimental results shown that the multiscale smoothing based foreground extraction model decreases the negative effect of inhomogeneous regions on foreground extraction, and the evaluation scores are higher than those of the traditional Graph cuts algorithm.

Abstract:Most existing models of recognizing textual entailment (RTE) get the interaction features between a premise and a hypothesis by an attention matrix at word level. However, the attention of important words should be different with the degree of understanding from diverse aspects, and only the local features are captured. To solve the problem above, the model with Multilevel Dynamic Gated Inference Network (MDGIN) is proposed, which combines the finegrained wordlevel information and sentencelevel gating mechanism to dynamically capture the relationships of text pairs. Moreover, the model extracts the different semantic features by diverse attention ways. In this paper, experiments are carried out on two textual datasets. Compared with the benchmark models and the existing mainstream models, the accuracy is improved by 0.4%~1.7%. The effectiveness of each part of the model is further verified by ablation analysis.

Abstract:Vibe algorithm is easy to produce ghost and slowmoving objects are easy to integrate into the background sample model. A new algorithm was proposed，first of all, using an iterative selection method to distinguish ghost shadow after detecting moving target with ViBe algorithm. Secondly, the edge feature of the image is obtained by using the improved Canny operator, and when the ViBe algorithm updates the background pixel model at the edge of the target, it does not update the pixel model of its neighborhood, so that the time of the slow moving target into the background pixel model is extended, and finally the complete moving target is obtained by morphological processing. Experimental results show that compared with the traditional ViBe algorithm, this algorithm can obtain higher detection accuracy more quickly in the case of ghosts, and the accuracy decreases later in the case of slow moving targets.

Abstract:In order to study speech enhancement in the air traffic control (ATC) and save storage resources, a new speech enhancement method is proposed. Based on Fully Convolutional Networks (FCN), Skip connection is added and secondary features are introduced for joint learning. Specifically, the logpower spectra(LPS) of speech is used as the main training feature, and the logarithmic MelFrequency Cepstrum (LMFCC) is introduced as the secondary training feature to jointly optimizeparameters of FCN. Experiments have shown that the network architecture combining LPS and LMFCC has better speech enhancement performances than that with single LPS feature, and the LMFCC as a secondary feature can also be used for other purposes. Experiments also show that the addition of skip connections can improve the FCN network performances, and the new network structure has better performances with the same number of parametersthan the baseline deep neural network (DNN) method.

Abstract:Singledomain based feature extraction has been extensively studied and is used to detect and classify Arrhythmia recently. In fact, multidomain feature extraction tends to perform better in classification. In this paper, threedomain features are extracted from timedomain, frequencydomain and waveletdomain using preprocessed ECG signals taken from 48 data sets in MIT/BIH arrhythmia database. These features fully characterize the nature of the ECG signals from various aspects. In the final stage, ECG signals are classified into four classes by the normalized features combined with gridsearch based SVM, the overall accuracy and F1 score of the proposed method is 98.01% and 0.9800 respectively, it performs well in detection and classification of ECG signals and has better generalization against the most results reported so far.

Abstract:In the magnetically coupled resonant wireless power transfer system, resonant coil structure is the key factor affecting the power transmission efficiency. Based on the circuit theory, the expression is deduced for the relationship between power transmission efficiency and circuit parameters. The power transmission efficiencies of the tapered resonant coil and the helical resonant coil were comparatively studied by numerical calculation. The results show that the energy transmission efficiency of the tapered resonant coil is higher when the axial spacing is within a certain range. The relationship between the structural parameters of the tapered resonant coil and the power transmission efficiency was further studied, and the optimization criterion of the resonant coil structure was proposed. The experimental results demonstrate that the power transmission efficiency of the tapered resonant coil is higher than that of the helical resonant coil.

Abstract:Through controlling the laser waveform of the two-color field, the selective enhancement of single-order harmonic is obtained theoretically. The theoretical analyses show that the selective enhancement of single-order harmonic is attributed to the folded region of the harmonic emission process in a specific 'W' waveform. Moreover, the folded region in the 'W' waveform structure is very sensitive to the pulse duration of the second controlling pulse. The present investigation provides a new method to obtain the single-order harmonic, which is helpful to the development of the laser source.

Abstract:The potential energy curves (PECs) of the 10 low-lying states of calcium monohydride (CaH) have been calculated using the internally contracted multi-reference configuration interaction plus Davidson modification (icMRCI+Q) approach with core-valence correlation and scalar relativistic corrections were taken into account. Avoided crossing in the B' and D state as well as other low-lying states was taken into account to explain a long-standing discrepancy between the experimental and theoretical analysis. The spectroscopic constants and molecular constants of the -S bound in more consistent with the experimental data have been obtained with the aid of LEVEL8.0 program fitting to the relevant potential energy curves. The results computed in this paper have certain reference value to further experimental and theoretical research of CaH molecule.

Abstract:With the great improvement of computer performance, analyzing the complex flow and heat transfer phenomenon by coupling CFD and neutronics has attracted lots of attentions nowadays. The study aims to investigate the neutron diffusion coupling calculation based on the UDF and UDS functions of FLUENT and its application analysis on fast reactor. The neutron diffusion equation is defined based on the UDF (User Defined function) and UDS (User Defined Scalar) functions of the FLUENT. The neutron diffusion equation is solved iteratively by using the solver of the FLUENT based on the finite volume method. At the same time, the mass, momentum and energy equations are solved iteratively. At each iteration, the power distribution (neutron flux distribution) obtained by the iteration of the neutron diffusion equation is transferred to the thermal-hydraulics calculation and is used as the heat source term. At the same time, the temperature distribution obtained from the thermal-hydraulics calculation is transferred to the neutron diffusion calculation and the macroscopic cross sections of the materials are corrected to realize the coupling calculation of the neutron diffusion and the thermal-hydraulics under the same solver of the FLUENT. Through the modeling and calculation of the 5×5 PWR assembly model and the hot assembly of a modular lead-cooled fast reactor (M2LFR-1000). It is proved that this method is feasible to realize the neutron diffusion and thermal-hydraulics coupling and the data transfer is correct. And the thermal hydraulics characteristics (the maximum fuel temperature and the maximum cladding outer surface temperature) of the M2LFR-1000 are all within the corresponding thermal‐hydraulics design limits.

Abstract:Using MPW1PW91/Aug-cc- PVTZ method and basis set, the physical properties of OH molecule under different electric fields were obtained, including the bond length, energy, vibration frequency, infrared spectrum, dipole moment, potential energy function and so on. Results show that with the increase of electric field, the energy decreases continuously, the frequency increases first and then decreases, and the dipole moment increases monotonously. The infrared spectrum has a blue shift. When the electric field is absent, the stimulated wavelength is located in the ultra-violate region, there is no energetic degeneration, the strength of oscillation is also influenced strongly, and some forbidden spectra are also stimulated up. Therefore, the electric field has a great influence on UV-VIs absorbing spectra. The Morse potential function is simulated, and the parameters are consistent with the values among experiments and literature. The electric field also declines the depth of potential of OH molecular, which makes the dissociating energy of OH molecular lower.

Abstract:BiVO4 nanocrystals were synthesized via a safe, green and energy-saving chemical protocol. The growth of the nanocrystals was regulated by changing the pH value of the reaction system. Furthermore, the formation mechanism and variation of spectral properties of the nanocrystals with different structures were explored. The results show that tetragonal BiVO4 is a thermally stable phase in acidic conditions. However, in weak alkaline conditions, the reaction tends to form monoclinic phase BiVO4 due to thermodynamics. In the strong alkaline conditions, the diffraction peak intensity of monoclinic BiVO4 decreases. All BiVO4 nanocrystals synthesized at different pH values are in the nanoscale. In the process of chemical synthesis, the pH value of the system plays a key role in the formed morphology of the sample. Bi3+ ions can exist in different forms at different pH values by hydrolysis, resulting in the synthesis routes of BiVO4 are different. And it makes BiVO4 samples synthesized at different pH conditions showing different structures. Raman spectroscopy was used to study the local structure of different BiVO4 nanocrystals. The peaks at 326 and 363 cm-1 are corresponded to the antisymmetric and symmetric bending vibrations of VO43- tetrahedron, while the peaks at 712 and 828 cm-1 are corresponded to the symmetric and antisymmetric tensile vibrations of V-O, respectively. Different BiVO4 nanocrystals have obvious absorption in the ultraviolet and visible regions, and the transition leads to the sharp decrease in the absorption boundary. The absorption band edge of BiVO4 nanocrystals with different crystal phases are obviously different, indicating that the internal electronic structure of the sample changes obviously. When the pH value is 3, the intensity of the luminescent peak of BiVO4 nanocrystal is the lowest, indicating that the material has the lowest electron-hole recombination efficiency, and suggesting that its photocatalytic activity is the highest.

Abstract:Compound 4-hydroxyphenylglyoxal hydrate was chosen as starting material, which can react with N-methoxylamine hydrochloride in one step of oximation reaction, affording phenolic natural product buxifoximes A in yield of 79%. Meanwhile, we also synthesized compound 2, a natural analogue of Buxifoximes A, according to a known procedure. Furthermore, the inhibitory effect of compound and compound 2 on cancer cell proliferation was evaluated and found to possess potent inhibitory activity against MV4-11. Meanwhile, preliminary structure–activity relationships for these two compounds are discussed.

Abstract:Based on the first-principles density functional theory calculations combined with the quasi-harmonic Debye model, the ground state structure, equation of state (EOS), elastic and thermal properties of YbB6 crystal are studied. The calculated results of the lattice constant, bulk modulus and elastic constants in YbB6 crystal are in good agreement with the experimental results. The research results of EOS show that the effects of pressure and temperature on the volume of YbB6 crystal are very significant, and the pressure has more influence on the volume of the YbB6 crystal under higher temperatures and lower pressures than that of case under the lower temperatures and lower pressures. Furthermore, the bulk modulus is greatly affected by the pressure compared with the temperature in the whole pressure and temperature ranges. The results of elastic constants and elasticity-relevant properties show that the YbB6 crystal is mechanically stable with a ductile manner and is solid with a central force field under zero temperature and 0 GPa pressure. The calculated values of the heat capacity and thermal expansion coefficient indicate that the influence of pressure on the heat capacity and expansion coefficient of YbB6 crystal is less than that of temperature.

Abstract:In this paper, we studied the geometries, stabilities, band structures and densities of states of copper, silver and gold doped phosphonenes. The biggest distortion of geometric structure is the structure of gold doped phosphonene, however, it is the most stable structure among three doped systems. The band structure of phosphonene can be tuned by doping copper, silver and gold metal atoms. Meanwhile, there are two impurity levels in the doped phosphonene systems, one donor level and one acceptor level, respectively. The enhancement of the conductivity of phosphonene is undeniable due to the introduction of impurity levels.

Abstract:At present, there is no chemical system for efficient synthesis of stereospecific phosphorothioate siRNAs (PS-siRNAs), this research designed the modified siRNA to target PLK1 for cancer therapy, enzymatically synthesized Rp phosphorothioate siRNAs (Rp-PS-siRNAs) with ATPaS, CTPaS, UTPaS by T7 RNA polymerase, and studied the differences between the nat-siRNAs and PS-siRNAs in serum stability and gene silencing activities. The data showed that the phosphorothioate modification introduced by the enzymatic catalysis could significantly improve the serum stability of siRNA while conserving the siRNA interference efficiency. Therefore, the Rp-PS-siRNA via enzymatic synthesis is of potential properties for developing siRNAs as biomedical research tools with a longer half-life in gene silencing.

Abstract:In order to study the effect of ARID1A on the migration of colon cancer cells, and to further analyze the mechanism of ARID1A regulating cell migration, the change of cell migration rate was observed by overexpression and interference of ARID1A gene in HCT116 cell line, and ARID1A co-expressed genes were screened out for GO and KEGG analysis by comparing the gene expression data between HCT116 and normal tissues. The results showed that overexpression of ARID1A reduced cell mobility, while the interference of this gene would lead to the opposite result. Among 1212 ARID1A coexpressed genes with a correlation coefficient greater than 0.9, there are only 4 genes involved in cell proliferation and 29 genes involved in cell migration, which are associated with chemokine signaling pathway, cytokine receptor interaction and other signaling pathways. It is suggested that ARID1A can inhibit cell migration and regulate cell migration through multiple signaling pathways.

Abstract:The purpose of this research was to study the association between polymorphisms of the ODF1 gene and idiopathic asthenozoospermia in Sichuan. We analyzed the distribution of the ODF1 gene polymorphism in 106 idiopathic asthenozoospermia and 104 fertile men with normospermic parameters. The result shows that the 27-bp deletion (c.656delACCCCTGCAGCCCCTGCAACCCGTGCA) was increased significantly in idiopathic asthenozoospermic patients compared with fertile counterparts (OR=1.783，95%CI=1.178~2.700，P=0.006) and ten amino acids (C218-P229delins NPCSPCNPCS) deletion were discovered by MEGA. Moreover, PROVEAN and PMP analysis predicted that this deletion mutation potentially damage to the function of protein. Therefore, these results suggested that the 27-bp deletion variant in ODF1 was highly likely to be one of the genetic factors for idiopathic asthenozoospermia among males in Sichuan.

Abstract:This study aims to elucidate the effects of different potato genotypes on rhizosphere microbial communities from the perspective of rhizosphere bacterial community structure, and to explore the characteristics of rhizosphere bacterial communities in high-altitude landraces and to identify the bacterial category playing an important role in colonization. The high-throughput sequencing of rhizosphere bacterial 16S rRNA genes was used to cluster the operational taxonomic units (OTUs) and the diversity characteristics of bacterial communities. We also used differential analysis of the abundance of OTU to identify the category of rhizosphere microorganism related to the genotypic effect. The sequencing results were quality controlled, and a total of 3 097 269 clean tags were obtained and clustered to 1 565 effective OTUs based on 97% sequence similarity. Overall, the bacterial category across different cultivars was almost the same, while the high-altitude landraces Purple potatoes and Horn potatoes showed a significant difference in the diversity of the rhizosphere microbial community. The abundance of OTU analysis between purple potatoes and the main variety Mira showed that the abundance of 55 OTUs in purple potatoes was significantly up-regulated and 143 was down-regulated. This study demonstrated that the diversity of potato rhizosphere bacterial community was affected by potato genotype factors, and the rhizosphere bacterial community structure of alpine landraces showed significant differences compared with local-breeding and main varieties.

Abstract:In order to explore the expression of HY5 in Brassica napus L., firstly, HY5 and its homologous gene HYH (HY5-Homologous) were predicted by genomic data analysis, and the full-length cDNA sequences of four duplication genes of HY5 (named BnHY5) were cloned. As well as three duplication HYH (named BnHYH) were also cloned. Then, we predicted and analyzed the protein structure of BnHY5 and its chemical properties. The results showed that BnHY5 protein is an unstable and hydrophilic protein, and the main domain is leucine zipper. Finally, BnHY5 duplication gene expression pattern was analyzed by real-time PCR with normal growth conditions and abiotic stress. The results showed that among 4 BnHY5 genes, BnHY5-2 has the highest expression level. BnHY5-1 and BnHY5-2 have no tissue expression differences and the expression level is higher than BnHY5-3, BnHY5-4. BnHY5 gene not only responds to high temperature, low temperature, cadmium, high salt abiotic stress but also participates in ABA and GA3 hormone signal responses, indicating that BnHY5 plays an important role in abiotic stress. In addition, compared with the expression of BnHY5 duplications in normal growth rape, the expression level of BnHY5 duplications under different types of stress treatment changed. The expression ratio of the four genes of BnHY5 has a relationship to different types of stress treatment.

Abstract:To study the composition and diversity of bile bacteria in patients with the sphincter of Oddi laxity (SOL), to provide basis for clinical treatment of cholelithiasis recurrence in patients with SOL, this study analyzed the differences of clinical indexes before operation, including liver and kidney function and blood routine index between control (non-SOL patients with cholelithiasis) and SOL group. The high-throughput 16S rRNA gene sequencing of biliary bacteria was performed based on the Illumina MiSeq platform. The results showed that the level of total bilirubin, direct bilirubin and indirect bilirubin in cholelithiasis patients with the SOL were significantly higher than those in the nonSOL group, while adenosine deaminase (ADA) was lower than that in control (P< 0.05). There was no significant difference in bacterial alpha diversity between SOL and non-SOL patients except for evenness (P> 0.05), and Wilcoxon rank-sum test showed that the top four abundant bacterial phyla in SOL patients bile were Proteobacteria, Firmicutes, Actinobacteria and Bacteroidete in turn, among which the abundance of Proteobacteria, Enterococcus and Lachnoclostridium was significantly higher in SOL patients than in control (P< 0.05), so did Klebsiella, Massilia and Pseudomonas (P>0.05). Therefore, there are significant differences in some clinical indexes such as bilirubin, ADA level and bile bacterial composition between patients with SOL and those without SOL, which provide relevant basis for the clinical treatment of cholelithiasis recurrence in patients with SOL.

Abstract:Relying on 60 thousand blogs and 15 thousand hot blog reviews in Sina micro-blog from January 1st to February 29th in 2020, this article launches the analysis of the public opinion to the topic about novel coronavirus pneumonia based on distributed crawler technology, distributed database system, SnowNLP sentiment analysis model and K-Means algorithm. This analysis can show visually the spatial and temporal evolution process of Internet public opinion in the events of this epidemic situation. On spatial dimension, the netizens' attitude towards this pneumonia epidemic has roughly gone through three periods. The first period appears in the shape of bigger fluctuation which presents as tension and anxiety. The second period appears in the shape of rising slowly which presents as unity and excitement. The third period appears in the shape of slight fluctuation which presents as confidence and stability. On the whole, it shows the emotional state that positive is greater than negative and Optimism is greater than pessimism. On spatial dimension, we find that the area which has the most serious epidemic has the most comments and the lowest emotional value through geographical statistical analysis.